grna-2 sequence  (GenScript corporation)

Journal: iScience

Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma

doi: 10.1016/j.isci.2023.108353

Figure Lengend Snippet:

Article Snippet: gRNA sequence 2: AUGUCACCUCUCCUCCACCA , Synthego , N/A.

Techniques: Recombinant, Lactate Dehydrogenase Assay, Cell Based Assay, Gene Knockout, Enzyme-linked Immunosorbent Assay, shRNA, Sequencing, Software, Gene Expression

Journal: Microbial Cell Factories

Article Title: Development of an industrial yeast strain for efficient production of 2,3-butanediol

doi: 10.1186/s12934-022-01924-z

Figure Lengend Snippet: Plasmids used in this work

Article Snippet: P58-PDC1 , P58 backbone with 2 gRNA targeting sequence for PDC1 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) , MCB, KU Leuven.

Techniques: Marker, Plasmid Preparation, Sequencing, Expressing

Journal: Nature Communications

Article Title: Ca 2+ -activated sphingomyelin scrambling and turnover mediate ESCRT-independent lysosomal repair

doi: 10.1038/s41467-022-29481-4

Figure Lengend Snippet: a Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNA targeting GFP (72 h) and GW4869 (10 µM) or DMSO (0.5%, 30 min) and pulse-treated with GPN. Data are means ± SD. n = 52 cells for DMSO and 39 cells for GW4869 over three independent experiments. b Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GW4869 or DMSO and pulse-treated with GPN. Data are means ± SD. n = 46 cells for DMSO and 44 cells for GW4869 over three independent experiments. c Survival rate of HeLa cells pre-treated with siRNA targeting GFP after 5 h of exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. d Survival rate of HeLa cells pre-treated with siRNA targeting ALIX/TSG101 after 5 h exposure to LLOMe at indicated concentrations in the presence of GW4869 or DMSO. Data are means ± SD. n = 3 independent experiments. e Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-1 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 28 cells for si nSMase-1 over three independent experiments. f Time-course plotting LysoTracker-positive puncta in HeLa cells pre-treated with siRNAs targeting ALIX/TSG101 and GFP or nSMase-2 and pulse-treated with GPN. Data are means ± SD. n = 28 cells for si GFP and 40 cells for si nSMase-2 over three independent experiments. g Time-course plotting LysoTracker-positive puncta in WT or nSMase-2 KO HeLa cells pulse-treated with GPN. Data are means ± SD. n = 58 cells for WT and 66 cells for nSMase-2 KO over three independent experiments. h Survival rate of wild-type (WT) or nSMase-2 KO HeLa cells after 5 h exposure to LLOMe at the indicated concentration. Data are means ± SD. n = 4 independent experiments. P values were calculated by paired ( c , d , h ) or unpaired two-tailed t test ( a , b , e , f , g ). i Model illustrating how Ca 2+ -activated SM scrambling and turnover may promote restoration of damaged lysosomes.

Article Snippet: To generate nSMase-2-KO and SMS1/SMS2 double-KO (SMS-KO) HeLa cells, a mix of CRISPR/Cas9 constructs encoding three different gRNAs per gene and the corresponding HDR plasmids were obtained from Santa Cruz (nSMase-2, sc401937; SMS1, sc-403382; SMS2, sc-405416). nSMase-2-specific gRNA sequences were: A/sense, 5′-CGTAGACCCCGACGTCGTAC-3′; B/sense, 5′-GAGTACATCCTGTACGACGT-3′; C/sense, 5′-GTGGCATTTGACGTCGTCTG-3′.

Techniques: Concentration Assay, Two Tailed Test